Unc5cem2(IMPC)Rbrc
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Unc5cem2(IMPC)Rbrc |
| Name: |
unc-5 netrin receptor C; endonuclease-mediated mutation 2, RIKEN BioResource Center |
| MGI ID: |
MGI:6156168 |
| Gene: |
Unc5c Location: Chr3:141171360-141540685 bp, + strand Genetic Position: Chr3, 65.57 cM
|
| Alliance: |
Unc5cem2(IMPC)Rbrc page
|
| IMPC: |
Unc5c gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at RIKEN BioResource Research Center using Cas9 and guides with spacer sequences GCAGTAGGTACCTATGAATT and TGTCCACTGAATCCATATAT that targeted exon(s) ENSMUSE00000498177.3. This resulted in deletion(s) of 4457 bp (location: Chr3:141436228-141440684; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Unc5c Mutation: |
61 strains or lines available
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
4 reference(s) |
|