Tgfbr2^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tgfbr2^{em1(IMPC)Rbrc}
• Name: transforming growth factor, beta receptor II; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6156162
• Gene: Tgfbr2 Location: Chr9:115916763-116004431 bp, - strand Genetic Position: Chr9, 68.39 cM
• Alliance: Tgfbr2^{em1(IMPC)Rbrc} page
• IMPC: Tgfbr2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at RIKEN BioResource Research Center using Cas9 and guides with spacer sequences GAAGCCGGTGCAGGAGAGTT and TGGGAAAAGAACCATCGCTC that targeted exon(s) ENSMUSE00000219766.4. This resulted in deletion(s) of 487 bp (location: Chr9:115958719-115959205; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tgfbr2 Mutation: 40 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)