Shank2^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shank2^{em1(IMPC)Rbrc}
• Name: SH3 and multiple ankyrin repeat domains 2; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6156158
• Gene: Shank2 Location: Chr7:143555665-143978231 bp, + strand Genetic Position: Chr7, 88.45 cM
• Alliance: Shank2^{em1(IMPC)Rbrc} page
• IMPC: Shank2 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at RIKEN BioResource Research Center using D10A and guides with spacer sequences GAATTCCTCAATGGGGGTAT and TACCTGGAGTCCGTGGATGA that targeted exon(s) ENSMUSE00001298379.2. This resulted in deletion(s) of 2 bp (location: Chr7:143840447-143840448; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Shank2 Mutation: 94 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)