Ppme1^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppme1^{em1(IMPC)Rbrc}
• Name: protein phosphatase methylesterase 1; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6156152
• Gene: Ppme1 Location: Chr7:99975944-100021103 bp, - strand Genetic Position: Chr7, 54.35 cM, cytoband F1
• Alliance: Ppme1^{em1(IMPC)Rbrc} page
• IMPC: Ppme1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at RIKEN BioResource Research Center using Cas9 and guides with spacer sequences AATCCTTATCTAGGGGATTC, ACTAGCTAATGAATTCATGC, GATAAGGATTGTGAATAAGT, and GCTACCTTAATATGCATTCA that targeted exon(s) ENSMUSE00000202295.2 ENSMUSE00000202308.2 ENSMUSE00002079084.1. This resulted in deletion(s) of 1102 bp (location: Chr7:99996681-99997782; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ppme1 Mutation: 22 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)