Pnma2^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pnma2^{em1(IMPC)Rbrc}
• Name: paraneoplastic antigen MA2; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6156150
• Gene: Pnma2 Location: Chr14:67148619-67158472 bp, + strand Genetic Position: Chr14, 34.6 cM
• Alliance: Pnma2^{em1(IMPC)Rbrc} page
• IMPC: Pnma2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at RIKEN BioResource Research Center using Cas9 and guides with spacer sequences ATTGGCCCATTTGACGGGGC and GGAATATCTTGCCTAGTAGC that targeted exon(s) ENSMUSE00000557112.5 ENSMUSE00000720599.3. This resulted in deletion(s) of 287 bp (location: Chr14:67153730-67154016; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pnma2 Mutation: 15 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)