About   Help   FAQ
Pnma2em1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
Summary
Symbol: Pnma2em1(IMPC)Rbrc
Name: paraneoplastic antigen MA2; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID: MGI:6156150
Gene: Pnma2  Location: Chr14:67148619-67158472 bp, + strand  Genetic Position: Chr14, 34.6 cM
Alliance: Pnma2em1(IMPC)Rbrc page
IMPC: Pnma2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJcl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at RIKEN BioResource Research Center using Cas9 and guides with spacer sequences ATTGGCCCATTTGACGGGGC and GGAATATCTTGCCTAGTAGC that targeted exon(s) ENSMUSE00000557112.5 ENSMUSE00000720599.3. This resulted in deletion(s) of 287 bp (location: Chr14:67153730-67154016; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pnma2 Mutation:  15 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory