Pnma2^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pnma2^{em1(IMPC)Rbrc}
• Name: paraneoplastic antigen MA2; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6156150
• Gene: Pnma2 Location: Chr14:67148619-67158472 bp, + strand Genetic Position: Chr14, 34.6 cM
• Alliance: Pnma2^{em1(IMPC)Rbrc} page
• IMPC: Pnma2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 RNA and 2 guide sequences CCGGCTACTAGGCAAGATATTCC, ATTGGCCCATTTGACGGGGCAGG, which resulted in a Intra-exdel deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pnma2 Mutation: 15 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)