Syt7em3(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Syt7em3(IMPC)H |
| Name: |
synaptotagmin VII; endonuclease-mediated mutation 3, Harwell |
| MGI ID: |
MGI:6156118 |
| Gene: |
Syt7 Location: Chr19:10366454-10430544 bp, + strand Genetic Position: Chr19, 6.58 cM, cytoband B
|
| Alliance: |
Syt7em3(IMPC)H page
|
| IMPC: |
Syt7 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, 3 guide sequences CCTGTAAACTATATCATCCACGG, GGGGGAGACTGTTACAGGCTAGG, TTGAGGGGGGAGACTGTTACAGG, and a donor oligo, which resulted in a Exon Deletion.
(J:237616, J:384794)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Syt7 Mutation: |
42 strains or lines available
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
4 reference(s) |
|