Gng11em2(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gng11em2(IMPC)H |
| Name: |
guanine nucleotide binding protein (G protein), gamma 11; endonuclease-mediated mutation 2, Harwell |
| MGI ID: |
MGI:6155632 |
| Gene: |
Gng11 Location: Chr6:4003987-4008445 bp, + strand Genetic Position: Chr6, 1.81 cM, cytoband A1
|
| Alliance: |
Gng11em2(IMPC)H page
|
| IMPC: |
Gng11 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 2 guide sequences CATCGAGGATCTGCCGGAAAAGG, CCCTTCACATCGAGGATCTGCCG, which resulted in a Indel.
(J:237616)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Gng11 Mutation: |
12 strains or lines available
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
1 reference(s) |
|