Lrba^em1Ccg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrba^em1Ccg
• Name: LPS-responsive beige-like anchor; endonuclease-mediated mutation 1, Christopher Goodnow
• MGI ID: MGI:6154626
• Synonyms: Lrba^-
• Gene: Lrba Location: Chr3:86131987-86689999 bp, + strand Genetic Position: Chr3, 37.83 cM, cytoband F1
• Alliance: Lrba^em1Ccg page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 37 was targeted using an sgRNA (targeting TTAACTGAGTTGCGGTCACATGG) with CRISPR/Cas9 technology, resulting in an 8 bp deletion eliminating ATGTGACC (GRCm39:chr3:86352699-86352706), leading to a frameshift and premature stop codon (H1949Rfs*29). (J:257099)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lrba Mutation: 138 strains or lines available

References

• Original: J:257099 Burnett DL, et al., Murine LRBA deficiency causes CTLA-4 deficiency in Tregs without progression to immune dysregulation. Immunol Cell Biol. 2017 Oct;95(9):775-788
• All: 1 reference(s)