Lrbaem1Ccg
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Lrbaem1Ccg |
| Name: |
LPS-responsive beige-like anchor; endonuclease-mediated mutation 1, Christopher Goodnow |
| MGI ID: |
MGI:6154626 |
| Synonyms: |
Lrba- |
| Gene: |
Lrba Location: Chr3:86131987-86689999 bp, + strand Genetic Position: Chr3, 37.83 cM, cytoband F1
|
| Alliance: |
Lrbaem1Ccg page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
Exon 37 was targeted using an sgRNA (targeting TTAACTGAGTTGCGGTCACATGG) with CRISPR/Cas9 technology, resulting in an 8 bp deletion eliminating ATGTGACC (GRCm39:chr3:86352699-86352706), leading to a frameshift and premature stop codon (H1949Rfs*29).
(J:257099)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Lrba Mutation: |
141 strains or lines available
|
|
| Original: |
J:257099 Burnett DL, et al., Murine LRBA deficiency causes CTLA-4 deficiency in Tregs without progression to immune dysregulation. Immunol Cell Biol. 2017 Oct;95(9):775-788 |
| All: |
1 reference(s) |
|