About   Help   FAQ
Lrbaem1Ccg
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrbaem1Ccg
Name: LPS-responsive beige-like anchor; endonuclease-mediated mutation 1, Christopher Goodnow
MGI ID: MGI:6154626
Synonyms: Lrba-
Gene: Lrba  Location: Chr3:86131987-86689999 bp, + strand  Genetic Position: Chr3, 37.83 cM, cytoband F1
Alliance: Lrbaem1Ccg page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 37 was targeted using an sgRNA (targeting TTAACTGAGTTGCGGTCACATGG) with CRISPR/Cas9 technology, resulting in an 8 bp deletion eliminating ATGTGACC (GRCm39:chr3:86352699-86352706), leading to a frameshift and premature stop codon (H1949Rfs*29). (J:257099)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lrba Mutation:  140 strains or lines available
References
Original:  J:257099 Burnett DL, et al., Murine LRBA deficiency causes CTLA-4 deficiency in Tregs without progression to immune dysregulation. Immunol Cell Biol. 2017 Oct;95(9):775-788
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory