About   Help   FAQ
Ap2a1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ap2a1em1(IMPC)J
Name: adaptor-related protein complex 2, alpha 1 subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6153953
Gene: Ap2a1  Location: Chr7:44549797-44578914 bp, - strand  Genetic Position: Chr7, 29.01 cM, cytoband B2
Alliance: Ap2a1em1(IMPC)J page
IMPC: Ap2a1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCATGCTGCAGACCGCACTGACA, CCCTCGTGTACCCTGCATTGCTA, CCCACGGCCAGTGTGACAGCACA and ACGTGACCAGGATATTACATAGG, which resulted in a 934 bp deletion beginning at Chromosome 7 position 44,909,004 bp and ending after 44,909,937 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000491996 and ENSMUSE00000497958 (exons 5 and 6) and 702 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 23 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ap2a1 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory