Ap2a1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ap2a1em1(IMPC)J |
| Name: |
adaptor-related protein complex 2, alpha 1 subunit; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6153953 |
| Gene: |
Ap2a1 Location: Chr7:44549797-44578914 bp, - strand Genetic Position: Chr7, 29.01 cM, cytoband B2
|
| Alliance: |
Ap2a1em1(IMPC)J page
|
| IMPC: |
Ap2a1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCATGCTGCAGACCGCACTGACA, CCCTCGTGTACCCTGCATTGCTA, CCCACGGCCAGTGTGACAGCACA and ACGTGACCAGGATATTACATAGG, which resulted in a 934 bp deletion beginning at Chromosome 7 position 44,909,004 bp and ending after 44,909,937 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000491996 and ENSMUSE00000497958 (exons 5 and 6) and 702 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 23 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|