Nanos2^em2(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nanos2^em2(IMPC)Bay
• Name: nanos C2HC-type zinc finger 2; endonuclease-mediated mutation 2, Baylor College of Medicine
• MGI ID: MGI:6153952
• Synonyms: Nanos2^em2Bay, Nanos2^KO
• Gene: Nanos2 Location: Chr7:18721449-18722887 bp, + strand Genetic Position: Chr7, 9.45 cM
• Alliance: Nanos2^em2(IMPC)Bay page
• IMPC: Nanos2 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Baylor College of Medicine by injecting CAS9 RNA and 2 guide sequences ACCTACCGCCCTTTGACATGTGG, CCGACGCAGTGGGCGAAACTCAG, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nanos2 Mutation: 16 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)