About   Help   FAQ
Nanos2em2(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Nanos2em2(IMPC)Bay
Name: nanos C2HC-type zinc finger 2; endonuclease-mediated mutation 2, Baylor College of Medicine
MGI ID: MGI:6153952
Synonyms: Nanos2em2Bay, Nanos2KO
Gene: Nanos2  Location: Chr7:18721449-18722887 bp, + strand  Genetic Position: Chr7, 9.45 cM
Alliance: Nanos2em2(IMPC)Bay page
IMPC: Nanos2 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Baylor College of Medicine by injecting CAS9 RNA and 2 guide sequences ACCTACCGCCCTTTGACATGTGG, CCGACGCAGTGGGCGAAACTCAG, which resulted in a Exon Deletion. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nanos2 Mutation:  16 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory