Slc22a17^em2(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc22a17^em2(IMPC)H
• Name: solute carrier family 22 (organic cation transporter), member 17; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6153883
• Gene: Slc22a17 Location: Chr14:55143761-55150589 bp, - strand Genetic Position: Chr14, 27.99 cM
• Alliance: Slc22a17^em2(IMPC)H page
• IMPC: Slc22a17 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and 4 guides with spacer sequences CAGCTGAAATCTGGGACCTA, GATGTATGAGGGTAAGATGC, and TACTTCAAAGCTGATGTATG that targeted exon(s) ENSMUSE00001049465.2 ENSMUSE00001445441.2. This resulted in deletion(s) of 394 bp (location: Chr14:55146993-55147386; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc22a17 Mutation: 24 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)