About   Help   FAQ
Slc7a14em1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc7a14em1(IMPC)H
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 14; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6153860
Gene: Slc7a14  Location: Chr3:31257007-31364527 bp, - strand  Genetic Position: Chr3, 15.17 cM
Alliance: Slc7a14em1(IMPC)H page
IMPC: Slc7a14 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and the guide sequence CCCAACGGTGACATAGCTGTAGG, which resulted in a Indel. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc7a14 Mutation:  40 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory