Nrrosem1(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nrrosem1(IMPC)H |
| Name: |
negative regulator of reactive oxygen species; endonuclease-mediated mutation 1, Harwell |
| MGI ID: |
MGI:6153859 |
| Gene: |
Nrros Location: Chr16:31961603-31984412 bp, - strand Genetic Position: Chr16, 22.4 cM
|
| Alliance: |
Nrrosem1(IMPC)H page
|
| IMPC: |
Nrros gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences TCGACGGAGTCGCTGACTGC and TGTTTGTGGACCTAGGTCGA that targeted exon(s) ENSMUSE00000414915.2 ENSMUSE00000736349.2 ENSMUSE00000814590.2. This resulted in deletion(s) of 50 bp (location: Chr16:31963784-31963833; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
3 reference(s) |
|