Slc17a7^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc17a7^em1(IMPC)H
• Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6153821
• Gene: Slc17a7 Location: Chr7:44813373-44825566 bp, + strand Genetic Position: Chr7, 29.16 cM
• Alliance: Slc17a7^em1(IMPC)H page
• IMPC: Slc17a7 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and 4 guides with spacer sequences GCCTGCTAGCCCCCACCGCA, GCCTTGCGGTGGGGGCTAGC, and TGATCCGGGAACATAAACGT that targeted exon(s) ENSMUSE00000532081.2 ENSMUSE00001938301.1 ENSMUSE00001938333.1. This resulted in deletion(s) of 907 bp (location: Chr7:44817748-44818654; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Slc17a7 Mutation: 42 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)