Rgs2^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rgs2^em1(IMPC)H
• Name: regulator of G-protein signaling 2; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6153812
• Gene: Rgs2 Location: Chr1:143875076-143879887 bp, - strand Genetic Position: Chr1, 62.56 cM
• Alliance: Rgs2^em1(IMPC)H page
• IMPC: Rgs2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences CAAGAGGTATTCACCTCAGG, GATAGGACTACATAACAGCC, GCTCATTATAGTCGGATGAA, and TATCACTGGGTTTAATCATG that targeted exon(s) ENSMUSE00001319006.2 ENSMUSE00001335263.2 ENSMUSE00001657209.1. This resulted in deletion(s) of 630 bp (location: Chr1:143878353-143878982; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rgs2 Mutation: 20 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)