Gemin5^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gemin5^em1(IMPC)H
• Name: gem nuclear organelle associated protein 5; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6153794
• Gene: Gemin5 Location: Chr11:58010828-58059365 bp, - strand Genetic Position: Chr11, 35.72 cM
• Alliance: Gemin5^em1(IMPC)H page
• IMPC: Gemin5 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences TAACAGGGGCCCGAACTGGAAGG, CCTTTGACAGCCCCGCTGAGCCC, AATCCTCTTCTTAGCGCCAGAGG, CCTCTTCTTAGCGCCAGAGGCTC, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gemin5 Mutation: 55 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)