About   Help   FAQ
Pcdh15em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcdh15em1(IMPC)Wtsi
Name: protocadherin 15; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6153753
Gene: Pcdh15  Location: Chr10:72935174-74485569 bp, + strand  Genetic Position: Chr10, 37.43 cM
Alliance: Pcdh15em1(IMPC)Wtsi page
IMPC: Pcdh15 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence TCCTCTGAGAATTGTAGCTCTGG, and a donor oligo, which resulted in a Point Mutation allele. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pcdh15 Mutation:  132 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory