About   Help   FAQ
Nudcd3em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Nudcd3em1(IMPC)Wtsi
Name: NudC domain containing 3; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6153752
Gene: Nudcd3  Location: Chr11:6055705-6150190 bp, - strand  Genetic Position: Chr11, 3.91 cM
Alliance: Nudcd3em1(IMPC)Wtsi page
IMPC: Nudcd3 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 Protein, the guide sequence CCCATGCGGTCCGAAGGGTGGCG, and a donor oligo, which resulted in a GGC to GAC (c.155G>A) change resulting in a glycine to aspartate substitution at amino acid 52. Expression of protein is substantially reduced in tissues. (J:237616, J:351330)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nudcd3 Mutation:  25 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory