Usp47^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Usp47^{em1(IMPC)Wtsi}
• Name: ubiquitin specific peptidase 47; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153698
• Gene: Usp47 Location: Chr7:111622692-111710591 bp, + strand Genetic Position: Chr7, 58.74 cM, cytoband F2
• Alliance: Usp47^{em1(IMPC)Wtsi} page
• IMPC: Usp47 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCAGTCTTCTGAGTATTGCCTAG, CCAGGACACACTTTCCATGGGTG, GTCATAATCTCAGCAAGTTCAGG, GAGCTTCAGAGCAAGATGACTGG, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Usp47 Mutation: 67 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)