About   Help   FAQ
Taf4bem1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Taf4bem1(IMPC)Wtsi
Name: TATA-box binding protein associated factor 4b; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6153682
Gene: Taf4b  Location: Chr18:14916302-15033416 bp, + strand  Genetic Position: Chr18, 8.28 cM
Alliance: Taf4bem1(IMPC)Wtsi page
IMPC: Taf4b gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CTTATAGTAAATAGTGAACATGG, CCTTTAGGCTCAGCTTCCTAGTC, CCACTATCTTCCTATAAATATGC, CCTTCATGTGTGGTCCTATATGG, which resulted in a Exon Deletion. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Taf4b Mutation:  50 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory