About   Help   FAQ
Sike1em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Sike1em1(IMPC)Wtsi
Name: suppressor of IKBKE 1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6153616
Gene: Sike1  Location: Chr3:102903056-102911230 bp, + strand  Genetic Position: Chr3, 45.25 cM, cytoband F3
Alliance: Sike1em1(IMPC)Wtsi page
IMPC: Sike1 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCAGCTGTTAGGAGGTTTGCCTT, CCAGTCTTAGACGTCATTGTCCA, CCTCTTCCATCCTTTAGTGGTCA, GTCAAGTTACCTCCCTCACCAGG, which resulted in a Exon Deletion. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sike1 Mutation:  14 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory