About   Help   FAQ
Nfkbizem1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Nfkbizem1(IMPC)Wtsi
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6153562
Gene: Nfkbiz  Location: Chr16:55631740-55659018 bp, - strand  Genetic Position: Chr16, 33.65 cM, cytoband C1.2-C1.3
Alliance: Nfkbizem1(IMPC)Wtsi page
IMPC: Nfkbiz gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences AGTAAGCATTAATGACTTCAAGG, CCATCTTAGCCGAGGCAGCACCC, CCTTCACCCTATTTAACGATACA, ATTTGGCACTTCTGACATGGTGG, which resulted in a Exon Deletion. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nfkbiz Mutation:  32 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory