Mrpl20^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrpl20^{em1(IMPC)Wtsi}
• Name: mitochondrial ribosomal protein L20; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153492
• Gene: Mrpl20 Location: Chr4:155887335-155893288 bp, + strand Genetic Position: Chr4, 87.44 cM, cytoband E2
• Alliance: Mrpl20^{em1(IMPC)Wtsi} page
• IMPC: Mrpl20 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Wellcome Sanger Institute using Cas9 and 4 guides with spacer sequences ATGGGCTCCCGAAGCCCGAC, GATGTTGACTTTCATTCCCG, and GCTAAGCTCCGGGGGCATGG that targeted exon(s) ENSMUSE00000185188.6 ENSMUSE00000792073.3 ENSMUSE00001316712.2 ENSMUSE00001316714.2. This resulted in deletion(s) of 448 bp (location: Chr4:155888091-155888538; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mrpl20 Mutation: 25 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)