Ly6f^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ly6f^{em1(IMPC)Wtsi}
• Name: lymphocyte antigen 6 family member F; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153484
• Gene: Ly6f Location: Chr15:75140270-75144084 bp, + strand Genetic Position: Chr15, 34.29 cM, cytoband E1
• Alliance: Ly6f^{em1(IMPC)Wtsi} page
• IMPC: Ly6f gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Wellcome Sanger Institute using Cas9 and guides with spacer sequences ATCTTGGCCCTGGAGGCCCG, GGAAGGAATAGTTGCAAATG, TAATACAGCCTGGTGGCTTG, and TGTGTCTGGGTAATACAGCC that targeted exon(s) ENSMUSE00000890667.2 ENSMUSE00001334345.2 ENSMUSE00001320868.2 ENSMUSE00001321166.2 ENSMUSE00001321208.2 ENSMUSE00001321633.2 ENSMUSE00001323279.2 ENSMUSE00001323324.2 ENSMUSE00001324768.2 ENSMUSE00001327328.2 ENSMUSE00001331351.2 ENSMUSE00001331767.2 ENSMUSE00001333027.2 ENSMUSE00001336011.2 ENSMUSE00001336094.2 ENSMUSE00001616279.1 ENSMUSE00001616288.1 ENSMUSE00001616289.1. This resulted in deletion(s) of 552 bp (location: Chr15:75143394-75143945; GRCm39), 100856 bp (location: Chr15:75144049-75244904; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ly6f Mutation: 12 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)