Ddx23^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddx23^{em1(IMPC)Wtsi}
• Name: DEAD box helicase 23; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153315
• Gene: Ddx23 Location: Chr15:98543015-98560775 bp, - strand Genetic Position: Chr15, 54.65 cM, cytoband F2
• Alliance: Ddx23^{em1(IMPC)Wtsi} page
• IMPC: Ddx23 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Wellcome Sanger Institute using Cas9 and guides with spacer sequences CTACTACCAGTGCCCAGCTA, GCATAAATAGGTTTCAGAGC, GGCACTGGTAGTAGCGGCAG, and TAGGTCGTGATGGCTGACCA that targeted exon(s) ENSMUSE00001303029.2. This resulted in deletion(s) of 328 bp (location: Chr15:98550663-98550990; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ddx23 Mutation: 34 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)