About   Help   FAQ
Acaa2em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Acaa2em1(IMPC)Wtsi
Name: acetyl-CoA acyltransferase 2; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6153268
Gene: Acaa2  Location: Chr18:74912283-74939278 bp, + strand  Genetic Position: Chr18, 50.76 cM
Alliance: Acaa2em1(IMPC)Wtsi page
IMPC: Acaa2 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCTGATGCTTCATTAAAGAGACA, CCAACTTAGAAGTATCAAATACG, GAAGAGCACGCAAGGGGGGTGGG, GGACATCCCGAAGGGCACAATGG, which resulted in a Exon Deletion. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Acaa2 Mutation:  25 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory