Trappc1em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Trappc1em1(IMPC)Mbp |
| Name: |
trafficking protein particle complex 1; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis |
| MGI ID: |
MGI:6152665 |
| Gene: |
Trappc1 Location: Chr11:69214812-69216619 bp, + strand Genetic Position: Chr11, 42.51 cM
|
| Alliance: |
Trappc1em1(IMPC)Mbp page
|
| IMPC: |
Trappc1 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AGAGGGTGACAAGCTACTTC and CTCCGAGAGCTTTCCCCCGA that targeted exon(s) ENSMUSE00000366224.2 ENSMUSE00000374380.2 ENSMUSE00000384026.2 ENSMUSE00000588664.3 ENSMUSE00000662058.2 ENSMUSE00000677545.2 ENSMUSE00000677548.3 ENSMUSE00001884399.1 ENSMUSE00001884402.1 ENSMUSE00001884406.1 ENSMUSE00001884409.1 ENSMUSE00002101403.1 ENSMUSE00002195871.1. This resulted in deletion(s) of 1639 bp (location: Chr11:69214855-69216493; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
4 reference(s) |
|