Spag11a^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spag11a^em1(IMPC)Mbp
• Name: sperm associated antigen 11A; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152651
• Gene: Spag11a Location: Chr8:19207902-19209594 bp, + strand Genetic Position: Chr8, 10.35 cM
• Alliance: Spag11a^em1(IMPC)Mbp page
• IMPC: Spag11a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences GTGGCCAATTTCTGCCTCTG, GTTCAAACATGGCCATTCTG, TGCTCTACTGAGTTAGGCTG, and TGGCTTCTCTCCTCTTGCTG that targeted exon(s) ENSMUSE00000359348.5 ENSMUSE00000464570.3 ENSMUSE00001390913.2. This resulted in deletion(s) of 3 bp (location: Chr8:19209938-19209940; GRCm39), 2081 bp (location: Chr8:19207730-19209810; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Spag11a Mutation: 6 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)