Slc2a13^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc2a13^em1(IMPC)Mbp
• Name: solute carrier family 2 (facilitated glucose transporter), member 13; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152644
• Gene: Slc2a13 Location: Chr15:91151899-91457464 bp, - strand Genetic Position: Chr15, 46.05 cM
• Alliance: Slc2a13^em1(IMPC)Mbp page
• IMPC: Slc2a13 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences ACTATGGCGAGTATGCACTC and ATTGTGCATAGGCACCAGGG that targeted exon(s) ENSMUSE00000319702.2. This resulted in deletion(s) of 3 bp (location: Chr15:91382408-91382410; GRCm39), 1098 bp (location: Chr15:91381189-91382286; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc2a13 Mutation: 31 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)