Pdf^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pdf^em1(IMPC)Mbp
• Name: peptide deformylase (mitochondrial); endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152609
• Gene: Pdf Location: Chr8:107772921-107775246 bp, - strand Genetic Position: Chr8, 53.55 cM
• Alliance: Pdf^em1(IMPC)Mbp page
• IMPC: Pdf gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CGGCTCCCCGGAACCCACGC and TGACAGAATACGATTACAGC that targeted exon(s) ENSMUSE00000580190.7 ENSMUSE00000335882.5 ENSMUSE00000373671.9 ENSMUSE00000459159.9. This resulted in deletion(s) of 4 bp (location: Chr8:107775320-107775323; GRCm39), 1621 bp (location: Chr8:107773577-107775197; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pdf Mutation: 9 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)