Or1e1c^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Or1e1c^em1(IMPC)Mbp
• Name: olfactory receptor family 1 subfamily E member 1C; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152529
• Gene: Or1e1c Location: Chr11:73262072-73266530 bp, + strand Genetic Position: Chr11, 45.32 cM
• Alliance: Or1e1c^em1(IMPC)Mbp page
• IMPC: Or1e1c gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences GCAGGTTGGGTAAAGGCCAG, GCTCAGAAGAATCTCTGATT, TGAAGGTGGCTTAGTGAAGG, and TGTATGACACAGATTGTCTG that targeted exon(s) ENSMUSE00000791152.3 ENSMUSE00001370800.2. This resulted in deletion(s) of 2 bp (location: Chr11:73264863-73264864; GRCm39), 5 bp (location: Chr11:73265044-73265048; GRCm39), 17 bp (location: Chr11:73266885-73266901; GRCm39), and 1689 bp (location: Chr11:73265124-73266812; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Or1e1c Mutation: 26 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)