Mybpc2em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
|
Symbol: |
Mybpc2em1(IMPC)Mbp |
Name: |
myosin binding protein C, fast-type; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis |
MGI ID: |
MGI:6152519 |
Gene: |
Mybpc2 Location: Chr7:44151123-44174080 bp, - strand Genetic Position: Chr7, 28.83 cM
|
Alliance: |
Mybpc2em1(IMPC)Mbp page
|
IMPC: |
Mybpc2 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 4 guide sequences CCAGTAAAACGCAGCAAAGTTAC, CCTATTGTTACAACAACCAAGAA, AAATGACACTTTCTATACTCTGG, GTTAGGCCTCCGAATGTGTAAGG, which resulted in a Exon Deletion.
(J:237616)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Mybpc2 Mutation: |
52 strains or lines available
|
|
Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
All: |
1 reference(s) |
|