About   Help   FAQ
Mtmr71em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Mtmr71em1(IMPC)Mbp
Name: myotubularin related protein 7; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6152518
Gene: Mtmr7  Location: Chr8:41004136-41087840 bp, - strand  Genetic Position: Chr8, 23.89 cM, cytoband B1.2
Alliance: Mtmr71em1(IMPC)Mbp page
IMPC: Mtmr7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

This allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 2 guide sequences CCGACAGACAAACAACCTAAGAA, CCACCATGTTCCTTAATTCCACG, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mtmr7 Mutation:  126 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory