Mtmr71^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mtmr71^em1(IMPC)Mbp
• Name: myotubularin related protein 7; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152518
• Gene: Mtmr7 Location: Chr8:41004136-41087840 bp, - strand Genetic Position: Chr8, 23.89 cM, cytoband B1.2
• Alliance: Mtmr71^em1(IMPC)Mbp page
• IMPC: Mtmr7 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 2 guide sequences CCGACAGACAAACAACCTAAGAA, CCACCATGTTCCTTAATTCCACG, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mtmr7 Mutation: 126 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)