About   Help   FAQ
Ipo7em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ipo7em1(IMPC)Mbp
Name: importin 7; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6152503
Synonyms: Ipo7-
Gene: Ipo7  Location: Chr7:109617522-109655816 bp, + strand  Genetic Position: Chr7, 57.7 cM
Alliance: Ipo7em1(IMPC)Mbp page
IMPC: Ipo7 gene page
Ipo7em1(IMPC)Mbp/Ipo7em1(IMPC)Mbp mice exhibit embryonic lethality. No embryos are recovered at E7.5 and abnormal blastocysts are recovered at E3.5. Blastocysts grown in vitro hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 4 guide sequences CCTTGATATTTGGTAGTAGGGCT, GTGCATTGTGTGTTCCATTGCGG, CCAGAAGAGGTTTGTGATCCTCT, GTAGGGATCAAACTTAGAGCTGG, which resulted in a Exon Deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 7 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ipo7 Mutation:  82 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory