Tafa3^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tafa3^em1(IMPC)Mbp
• Name: TAFA chemokine like family member 3; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152486
• Gene: Tafa3 Location: Chr3:104674721-104686854 bp, - strand Genetic Position: Chr3, 45.84 cM, cytoband F2.2
• Alliance: Tafa3^em1(IMPC)Mbp page
• IMPC: Tafa3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AGGACAGAGCATCCGACTAG, AGTCTCCTGGCCTAATTCTG, GGGGAAGGTGTTCTGCAGTG, and GGGGACAGTCTGTGGTGAGG that targeted exon(s) ENSMUSE00000424932.4 ENSMUSE00000424938.2 ENSMUSE00001350131.2 ENSMUSE00001352321.2. This resulted in deletion(s) of 21 bp (location: Chr3:104680902-104680922; GRCm39), 1888 bp (location: Chr3:104678979-104680866; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tafa3 Mutation: 6 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)