Ddias^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddias^em1(IMPC)Mbp
• Name: DNA damage-induced apoptosis suppressor; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152456
• Gene: Ddias Location: Chr7:92506734-92523455 bp, - strand Genetic Position: Chr7, 51.64 cM, cytoband E2
• Alliance: Ddias^em1(IMPC)Mbp page
• IMPC: Ddias gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AAGTAAGCATCTACTTTGGG, ATTAGATTATACTCTAAACG, GCACTACCAAATGAGCACTA, and TTTGATGCACTGGGTTTAGG that targeted exon(s) ENSMUSE00000201530.4. This resulted in deletion(s) of 372 bp (location: Chr7:92509922-92510293; GRCm39), 725 bp (location: Chr7:92510299-92511023; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ddias Mutation: 55 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)