About   Help   FAQ
Emilin2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Emilin2em1(IMPC)J
Name: elastin microfibril interfacer 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6151442
Gene: Emilin2  Location: Chr17:71559167-71618551 bp, - strand  Genetic Position: Chr17, 41.87 cM
Alliance: Emilin2em1(IMPC)J page
IMPC: Emilin2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences TGGTGTTGTTACCAAGGACA and GGAGACTCTCTTAAAACTAG, which resulted in a 300 bp deletion beginning at Chromosome 17 position 71,280,606 bp and ending after 71,280,905 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000235473 (exon 3) and 124 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 6 bp insertion (TCTAAG) at the deletion site, that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 91 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Emilin2 Mutation:  56 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory