About   Help   FAQ
Krt25em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Krt25em1(IMPC)J
Name: keratin 25; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6151423
Gene: Krt25  Location: Chr11:99206342-99213777 bp, - strand  Genetic Position: Chr11, 62.92 cM
Alliance: Krt25em1(IMPC)J page
IMPC: Krt25 gene page
Mutation
origin
Strain of Origin:  Not Specified
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAGAGGCCAGCCTTAGCCG, GTGAGCGAAAAGAATCCATG, GCATGCTACATGATTACTAG and TTAAGGGCATTTAAGGGCAT, which resulted in a 357 bp deletion beginning at Chromosome 11 position 99,321,844 bp and ending after 99,322,200 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000972994 (exon 2) and 274 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 10 bp deletion (ATCCCTTAAA) 160 bp after the 357 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 139 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Krt25 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory