Krt25^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt25^em1(IMPC)J
• Name: keratin 25; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6151423
• Gene: Krt25 Location: Chr11:99206342-99213777 bp, - strand Genetic Position: Chr11, 62.92 cM
• Alliance: Krt25^em1(IMPC)J page
• IMPC: Krt25 gene page

Mutation origin

• Strain of Origin: Not Specified
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAGAGGCCAGCCTTAGCCG, GTGAGCGAAAAGAATCCATG, GCATGCTACATGATTACTAG and TTAAGGGCATTTAAGGGCAT, which resulted in a 357 bp deletion beginning at Chromosome 11 position 99,321,844 bp and ending after 99,322,200 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000972994 (exon 2) and 274 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 10 bp deletion (ATCCCTTAAA) 160 bp after the 357 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 139 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Krt25 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)