About   Help   FAQ
Cherpem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cherpem1(IMPC)J
Name: calcium homeostasis endoplasmic reticulum protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6151421
Gene: Cherp  Location: Chr8:73214333-73229070 bp, - strand  Genetic Position: Chr8, 35.08 cM
Alliance: Cherpem1(IMPC)J page
IMPC: Cherp gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCTGTTGCCAAATTCTATA, CCATTCTTAATGAGTAGGGA, CATCAGGTCCTCTCTCTGGA and CAGTGAGATCAAGCACAACA, which resulted in a 525 bp deletion beginning at Chromosome 8 position 72,470,672 bp and ending after 72,471,196 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000463654 (exon 3) and 340 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp insertion (CT) at the deletion site. This deletion is predicted to cause a change of amino acid sequence after residue 66 and early truncation 29 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cherp Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory