About   Help   FAQ
Naa16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Naa16em1(IMPC)J
Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6151419
Gene: Naa16  Location: Chr14:79571947-79628228 bp, - strand  Genetic Position: Chr14, 42.61 cM, cytoband D3
Alliance: Naa16em1(IMPC)J page
IMPC: Naa16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATGTTTCGAGTGAATCTT, TATCTGAAGCACTTCTGAGA, ATTAATTTCAGCATTAAGTG and GTCTCTATCTCTTACAATAG, which resulted in a 492 bp deletion beginning at Chromosome 14 position 79,386,780 bp and ending after 79,387,271 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001292003 (exon 2) and 407 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Naa16 Mutation:  47 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory