Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy
Transgene Detail
|
|
| Symbol: |
Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy |
| Name: |
transgene insertion 27, Wei Yang |
| MGI ID: |
MGI:6150882 |
| Synonyms: |
Sumo-KD |
| Transgene: |
Tg(Thy1-EGFP/RNAi:Sumo)27Weiy Location: unknown
|
| Alliance: |
Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy page
|
|
|
|
| Transgene Type: |
|
Transgenic (Knockdown, Reporter) |
| Mutation: |
|
Insertion
|
|
|
Tg(Thy1-EGFP/RNAi:Sumo3/RNAi:Sumo2/RNAi:Sumo1)27Weiy involves 3 genes/genome features (Sumo1, Sumo3, Sumo2)
View all
|
| |
|
Mutation details: The transgene was designed to have (from 5' to 3') the ~6.5 kbp mouse Thy1 promoter for neuron-specific expression (Thy1 sequences extending from the promoter to the intron following exon 4, excluding exon 3 and its flanking introns), EGFP, a fragment containing three chained pre-miRNA sequences (AATCGAATCTGCCTCATTGAC, GTTTGTCAATGAGGCAGATCA, GGTCAGAGAATTGCTGATAAT) that target/silence SUMO3, SUMO2 and SUMO1 (respectively) and a polyadenylation signal. Six founder lines were generated, founder 27 exhibits widespread expression in the brain.
(J:260337)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 1 strain available
Cell Lines: 0 lines available
|
|
| Original: |
J:260337 Wang L, et al., Neuron-specific Sumo1-3 knockdown in mice impairs episodic and fear memories. J Psychiatry Neurosci. 2014 Jul;39(4):259-66 |
| All: |
1 reference(s) |
|