About   Help   FAQ
Pmpcaem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pmpcaem1(IMPC)J
Name: peptidase (mitochondrial processing) alpha; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6149992
Gene: Pmpca  Location: Chr2:26279351-26287134 bp, + strand  Genetic Position: Chr2, 18.88 cM
Alliance: Pmpcaem1(IMPC)J page
IMPC: Pmpca gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTTCTCCTCTCTTCACAG, CAGCTGGTCTAAATGAAGAC, GAAGGGCTATAACTTCCTGT and ATGGCATTCATGCTTACACA, which resulted in a 525 bp deletion beginning at Chromosome 2 position 26,390,877 bp and ending after 26,391,401 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000164354 (exon 5) and 430 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid residue 145. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pmpca Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory