About   Help   FAQ
Ankrd28em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ankrd28em1(IMPC)J
Name: ankyrin repeat domain 28; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6149988
Gene: Ankrd28  Location: Chr14:31420725-31552608 bp, - strand  Genetic Position: Chr14, 19.4 cM
Alliance: Ankrd28em1(IMPC)J page
IMPC: Ankrd28 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTACTTTAAGCACCCAAAAC, ATGGAACTAATAAGTCTGTA, GGGTGGTTTGGCTCAAGCCA and AGTCTCGCCAACAAAATCTT, which resulted in a 385 bp deletion beginning at Chromosome 14 position 31,764,067 bp and ending after 31,764,451 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349484 (exon 3) and 306 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 29 bp intronic deletion, Chr 14 :31,764,516 -31,764,544, which is 64 bp before the 385 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 37 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ankrd28 Mutation:  80 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory