Ankrd28em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ankrd28em1(IMPC)J |
Name: |
ankyrin repeat domain 28; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6149988 |
Gene: |
Ankrd28 Location: Chr14:31420725-31552608 bp, - strand Genetic Position: Chr14, 19.4 cM
|
Alliance: |
Ankrd28em1(IMPC)J page
|
IMPC: |
Ankrd28 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTACTTTAAGCACCCAAAAC, ATGGAACTAATAAGTCTGTA, GGGTGGTTTGGCTCAAGCCA and AGTCTCGCCAACAAAATCTT, which resulted in a 385 bp deletion beginning at Chromosome 14 position 31,764,067 bp and ending after 31,764,451 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349484 (exon 3) and 306 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 29 bp intronic deletion, Chr 14 :31,764,516 -31,764,544, which is 64 bp before the 385 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 37 and early truncation 11 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|