Ankrd28^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankrd28^em1(IMPC)J
• Name: ankyrin repeat domain 28; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6149988
• Gene: Ankrd28 Location: Chr14:31420725-31552608 bp, - strand Genetic Position: Chr14, 19.4 cM
• Alliance: Ankrd28^em1(IMPC)J page
• IMPC: Ankrd28 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTACTTTAAGCACCCAAAAC, ATGGAACTAATAAGTCTGTA, GGGTGGTTTGGCTCAAGCCA and AGTCTCGCCAACAAAATCTT, which resulted in a 385 bp deletion beginning at Chromosome 14 position 31,764,067 bp and ending after 31,764,451 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349484 (exon 3) and 306 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 29 bp intronic deletion, Chr 14 :31,764,516 -31,764,544, which is 64 bp before the 385 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 37 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ankrd28 Mutation: 80 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)