Cep350em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cep350em1(IMPC)J |
| Name: |
centrosomal protein 350; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6149747 |
| Gene: |
Cep350 Location: Chr1:155720710-155848976 bp, - strand Genetic Position: Chr1, 67.64 cM
|
| Alliance: |
Cep350em1(IMPC)J page
|
| IMPC: |
Cep350 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGAGTTGATAGGTAGGG, AGACACTGCAGTAGGGTCTC, GGATACTCAGTTCACACCGA and GCATTGGATAAGGGCTGAAG, which resulted in a 392 bp deletion beginning at Chromosome 1 position 155,960,980 bp and ending after 155,961,371 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000537328 (exon 3) and 348 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a small indel, a 1 bp (T) insertion and 4 bp (GGTA) deletion, 88 bp after the 392 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 24 and early truncation 4 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|