About   Help   FAQ
Cep350em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cep350em1(IMPC)J
Name: centrosomal protein 350; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6149747
Gene: Cep350  Location: Chr1:155720710-155849001 bp, - strand  Genetic Position: Chr1, 67.64 cM
Alliance: Cep350em1(IMPC)J page
IMPC: Cep350 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGAGTTGATAGGTAGGG, AGACACTGCAGTAGGGTCTC, GGATACTCAGTTCACACCGA and GCATTGGATAAGGGCTGAAG, which resulted in a 392 bp deletion beginning at Chromosome 1 position 155,960,980 bp and ending after 155,961,371 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000537328 (exon 3) and 348 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a small indel, a 1 bp (T) insertion and 4 bp (GGTA) deletion, 88 bp after the 392 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 24 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cep350 Mutation:  112 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory