Fam24b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam24b^em1(IMPC)J
• Name: family with sequence similarity 24 member B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6149736
• Gene: Fam24b Location: Chr7:130927673-130931245 bp, - strand Genetic Position: Chr7, 73.84 cM, cytoband F4
• Alliance: Fam24b^em1(IMPC)J page
• IMPC: Fam24b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GTGGTATAAGAAATATAACT and GCCTTCTCTATTATCCTCCT, which resulted in a 648 bp deletion beginning at Chromosome 7 position 131,325,916 bp for 46 bp to 131,325,962 bp retaining 3 bp, TTA, and then an additional 602 bp deletion ending after 131,326,566 (GRCm38/mm10). This mutation deletes ENSMUSE00001326894 (exon 4) and 267 bp of flanking intronic sequence including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam24b Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)