About   Help   FAQ
Fam24bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fam24bem1(IMPC)J
Name: family with sequence similarity 24 member B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6149736
Gene: Fam24b  Location: Chr7:130927673-130931245 bp, - strand  Genetic Position: Chr7, 73.84 cM, cytoband F4
Alliance: Fam24bem1(IMPC)J page
IMPC: Fam24b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GTGGTATAAGAAATATAACT and GCCTTCTCTATTATCCTCCT, which resulted in a 648 bp deletion beginning at Chromosome 7 position 131,325,916 bp for 46 bp to 131,325,962 bp retaining 3 bp, TTA, and then an additional 602 bp deletion ending after 131,326,566 (GRCm38/mm10). This mutation deletes ENSMUSE00001326894 (exon 4) and 267 bp of flanking intronic sequence including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fam24b Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory