Fam24bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Fam24bem1(IMPC)J |
Name: |
family with sequence similarity 24 member B; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6149736 |
Gene: |
Fam24b Location: Chr7:130927673-130931245 bp, - strand Genetic Position: Chr7, 73.84 cM, cytoband F4
|
Alliance: |
Fam24bem1(IMPC)J page
|
IMPC: |
Fam24b gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GTGGTATAAGAAATATAACT and GCCTTCTCTATTATCCTCCT, which resulted in a 648 bp deletion beginning at Chromosome 7 position 131,325,916 bp for 46 bp to 131,325,962 bp retaining 3 bp, TTA, and then an additional 602 bp deletion ending after 131,326,566 (GRCm38/mm10). This mutation deletes ENSMUSE00001326894 (exon 4) and 267 bp of flanking intronic sequence including the splice acceptor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 10 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|