About   Help   FAQ
Stk3em1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Stk3em1(IMPC)H
Name: serine/threonine kinase 3; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6149213
Gene: Stk3  Location: Chr15:34875645-35155990 bp, - strand  Genetic Position: Chr15, 14.34 cM, cytoband B3.3
Alliance: Stk3em1(IMPC)H page
IMPC: Stk3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation details This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences CTTGCAGATTTTGGAGTGGC and TGTATTGAGGAGAATATTCC that targeted exon(s) ENSMUSE00001298521.2. This resulted in deletion(s) of 1 bp (location: Chr15:35073268-35073268; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Stk3 Mutation:  48 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory