Bud23^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bud23^em1(IMPC)H
• Name: BUD23, rRNA methyltransferase and ribosome maturation factor; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6149189
• Gene: Bud23 Location: Chr5:135081811-135093813 bp, - strand Genetic Position: Chr5, 74.97 cM
• Alliance: Bud23^em1(IMPC)H page
• IMPC: Bud23 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences GGAGCTGGCTCAGTGATCAC, GGCAGGCGTGTCCCAAGTTA, GTATTCTGTGTATGAAATGC, and TCCCAAGTTAGGGACTAGCC that targeted exon(s) ENSMUSE00001257914.2 ENSMUSE00001295400.2. This resulted in deletion(s) of 469 bp (location: Chr5:135089466-135089934; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Bud23 Mutation: 25 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)