About   Help   FAQ
Pkhd1l1em1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Pkhd1l1em1(IMPC)H
Name: polycystic kidney and hepatic disease 1-like 1; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6149161
Gene: Pkhd1l1  Location: Chr15:44320890-44464765 bp, + strand  Genetic Position: Chr15, 16.91 cM, cytoband B3
Alliance: Pkhd1l1em1(IMPC)H page
IMPC: Pkhd1l1 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCTATATACATCAAGTCTTCCTG, CCACCTATATACATCAAGTCTTC, CCACATGCCAATATCCAGAGGCT, CCAATATCCAGAGGCTTGTGCTC, which resulted in a Exon Deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 3 strains available      Cell Lines: 0 lines available
Carrying any Pkhd1l1 Mutation:  242 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory