Chmp2b^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chmp2b^em1(IMPC)Mbp
• Name: charged multivesicular body protein 2B; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6149048
• Gene: Chmp2b Location: Chr16:65336014-65359612 bp, - strand Genetic Position: Chr16, 37.26 cM, cytoband C1.3
• Alliance: Chmp2b^em1(IMPC)Mbp page
• IMPC: Chmp2b gene page

Mutation origin

• Strain of Origin: C57BL/6J
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AAGCAGCGTTCAGTCCTTTG, CATCAGCACTATATGGATGT, CGCAAGAAAGCAATTACGAG, and GAAAAGGGTGCCCTTGTGTG that targeted exon(s) ENSMUSE00000426256.4. This resulted in deletion(s) of 588 bp (location: Chr16:65347720-65348307; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Chmp2b Mutation: 26 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)