About   Help   FAQ
Gucy2cem1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
Summary
Symbol: Gucy2cem1(IMPC)Rbrc
Name: guanylate cyclase 2c; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID: MGI:6148318
Synonyms: Gucy2cem1Rbrc
Gene: Gucy2c  Location: Chr6:136674282-136758740 bp, - strand  Genetic Position: Chr6, 66.67 cM
Alliance: Gucy2cem1(IMPC)Rbrc page
IMPC: Gucy2c gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences CCATTGCGGCAGTTCTGCCTCAC, GCCCAGAACACCATCAGCGCGGG, which resulted in a Indel. (J:237616, J:384794)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gucy2c Mutation:  67 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory