Gucy2cem1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
|
Symbol: |
Gucy2cem1(IMPC)Rbrc |
Name: |
guanylate cyclase 2c; endonuclease-mediated mutation 1, RIKEN BioResource Center |
MGI ID: |
MGI:6148318 |
Synonyms: |
Gucy2cem1Rbrc |
Gene: |
Gucy2c Location: Chr6:136674282-136758740 bp, - strand Genetic Position: Chr6, 66.67 cM
|
Alliance: |
Gucy2cem1(IMPC)Rbrc page
|
IMPC: |
Gucy2c gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences CCATTGCGGCAGTTCTGCCTCAC, GCCCAGAACACCATCAGCGCGGG, which resulted in a Indel.
(J:237616)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Gucy2c Mutation: |
69 strains or lines available
|
|
Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
All: |
2 reference(s) |
|