Gucy2c^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gucy2c^{em1(IMPC)Rbrc}
• Name: guanylate cyclase 2c; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6148318
• Synonyms: Gucy2c^em1Rbrc
• Gene: Gucy2c Location: Chr6:136674282-136758740 bp, - strand Genetic Position: Chr6, 66.67 cM
• Alliance: Gucy2c^{em1(IMPC)Rbrc} page
• IMPC: Gucy2c gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences CCATTGCGGCAGTTCTGCCTCAC, GCCCAGAACACCATCAGCGCGGG, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gucy2c Mutation: 68 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)